Tropicultura

0771-3312 2295-8010

 

since 10 March 2019 :
View(s): 51 (5 ULiège)
Download(s): 0 (0 ULiège)
print        
M. Douifi, N. Ouchene, A. Hakem & K. Rahal

Dermanyssus gallinae in Laying Hen Houses in Algeria, Infestation Prevalence and Molecular Detection of Salmonella

Article
Open Access

Editor's Notes

Received on 17.01.18 and accepted for publication on 21.03.18

Résumé

Dermanyssus gallinae dans les bâtiments de poules pondeuses en Algérie, prévalence d’infestation et détection moléculaire de Salmonella

Le pou rouge, Dermanyssus gallinae, est le plus important et le plus courant ectoparasite des poules pondeuses. Il est reconnu comme le vecteur de plusieurs agents pathogènes, y compris Salmonella. Ce dernier est un important agent provoquant des toxi-infections alimentaires dans le monde entier. Dans le but d’investiguer le taux d’infestation par Dermanyssus gallinae, 386 bâtiments d’élevage de poules pondeuses ont été étudiés dans quatre provinces du Nord-est de l’Algérie (Brouira, Bordj Bouarreridj, Setif and Batna). Un total de 32 pools de poux a été examiné. Chaque pool contenait 100 individus et la technique de PCR a été utilisée pour déceler la présence de Salmonella enterica, S. typhimurium et S. enteritidis. Les résultats ont montré que 54 bâtiments étaient infestés par D. gallinae (14%). La province de Bouira a enregistré la prévalence la plus élevée (18,18 %). Les bandes âgées de plus de 40 semaines sont les plus atteintes (p ˂ 0.001). Le DNA de Salmonella enterica a été détecté dans 8 pools de poux (25%) et celui de Salmonella enteritidis dans deux pools (6,25%). Ces résultats indiquent que D. gallinae peut agir comme réservoir de Salmonella, permettant sa persistance dans les élevages et sa transmission entre bandes et entre bâtiments.

Abstract

The red mite, Dermanyssus gallinae, is the most important and common ectoparasite of laying hens and it’s recognized as a vector of several pathogens, including Salmonella an important agent of food intoxication outbreaks worldwide. In order to investigate Dermanyssus gallinae infestation rate, a total of 386 laying hen farms was studied in four provinces located in north-eastern Algeria (Brouira, Bordj Bouarreridj, Setif and Batna). A total of 32 pooled mite samples were examined for the presence of Salmonella enterica, S. typhimurium and S. enteritidis using PCR essay. Each sample contained 100 red mites. Results showed that 54 out of 386 farms (14%) were infested by D. gallinae. Bouira province had recorded the highest prevalence rate (18.18%). Flocks older than 40 weeks were most affected by the red mite (p ˂ 0.001). Salmonella enterica DNA was detected in 8 samples (25%), including two Salmonella enteritidis (6.25%). These results indicate that Dermanyssus gallinae can act as a reservoir of Salmonella allowing its persistence in the poultry environment and its transmission between different production cycles and between hen housings.

Index by keyword : laying hen housing, Dermanyssus gallinae, prevalence, Salmonella, vector, Algeria

Introduction

1The poultry red mite PRM (Dermanyssus gallinae) is a common concern among poultry egg farmers in both developed and developing countries (23) and remains an unresolved problem (22). The average prevalence in European countries was estimated at 80% (10), with economic losses of approximately 130 million Euros annually (28).

2The poultry red mite is a haematophagous ectoparasite of poultry and wild birds (25). It feeds on resting birds, mainly during the night. However, during the day, these mites hide in the crevices and cracks of walls and equipment. Under favourable conditions, the PRM life cycle is accomplished in a week, favouring the development of an intense short-term infestation, which may result in egg production dropping, mortality, reduced hen immunity and itching dermatitis in humans (9, 18).

3When the red mite is discovered, the problem is generally already very pronounced. Its ability to hide in crevices, which are difficult to reach by insecticide treatment, the prohibition of several acaricides use during the production cycle and the development of resistance to several insecticide products, makes eliminating this mite very difficult (19).

4Moreover, the potential of D. gallinae to transmit animal pathogens appears to be an important and emerging problem (21). D. gallinae are potential vectors of several pathogens including Salmonella (13). Poultry are the most important sources of this bacterium that can be transmitted to humans. Salmonella are responsible for some of the most widespread zoonoses in the world (6).

5Despite several studies in European and developing countries, describing different problems posed by this poultry pest (24), there is no published work about red mite infestation in Algeria. The purposes of the present study were to confirm the role of D. gallinae as a natural vector of Salmonella and, to evaluate the prevalence of mite infestation and subsequent economic losses.

Materials and Methods

Study area

6The study was conducted during the period from September to December 2014 in four provinces (Bouira, Bordj Bouarreridj, Setif and Batna) in North-eastern Algeria.

7These regions have a sub-humid (Bouira) and semi-arid (Setif, Bordj Bouarreridj and Batna) climate, characterized by hot summers and cold, wet winters with a rainfall averaging between 300 and 650 mm per year.

8Samples

9The survey was conducted with the practitioner veterinaries who accepted to participate in this work. Out of about 2000 layer farms 386 were investigated for D. gallinae infestation. The number of these farms in Bouira, Bourdj bouarreridj, Setif and Batna regions was 88, 102, 85 and 111, respectively.

10The data about drop in egg production and the mortality rate were provided by the owner of the farms, hygiene conditions and the number of laying hens housed in each farm were recorded.

Laboratory analysis

11Samples of D. gallinae were collected from cages of hens according to Cencek (3) and placed in plastic tubes containing 70° ethanol solution. Mite numbers were assessed and D. gallinae identification was made under an optical microscope at × 100 magnification (7, 21).

12A total of 32 pooled mite samples were examined for the presence of Salmonella enterica, S. typhimurium and S. enteritidis using PCR essay. Each sample contained 100 red mites.

13Bacterial DNA was extracted using Dneasy Tissue Kit (QIAGEN) according to the manufacturer’s instructions. Extracted DNA was stored at - 20°C.

14The polymerase chain reaction protocol was performed in two steps according to Liu et al. (14). The specific primers used are presented in Table 1.

15PCR amplifications were performed in a Thermal Cycler with a cycling program. Amplification products were determined by electrophoresis using 2% agarose gels, stained with ethidium bromide, and visualized under UV light.

Table 1: The target genes and their sequencing primers (Liu et al. 2012)

Target

Gene

Primer set name

Sequences (5e3)

PCR product (bp)

S. typhimurium

STM4495

stm-4495

GGTGGCAAGGGAATGAA CGCAGCGTAAAGCAACT

915

S. enteritidis

SEN1392

sen-1392

GCCACTGTCTGATGCTCTTG

GAAAGGCTCCGTGGTTAGT

656

S. enterica

srfC

FS23

GGCGTTAACCCACTCCAGTA TTACTGTGGGGAGAGCAACC

492

Statistical Analysis

16The statistical program used was R i386 3.0.2 for Windows GUI front-end. Chi-square test was used to compare the prevalence of infestation between different regions and to study the influence of hens’ age on prevalence of infestation by D. gallinae. Differences were considered as significant when P value was less than 0.05.

17Results

18D. gallinae mites were collected from 54 out of 386 farms, resulting in an infestation prevalence of 14%. Highest prevalence of infestation was observed in Bouira region (18.18%) in comparison with Bourdj Bouarreridj, Setif and Batna regions (p< 0.001). However, no significant difference was observed between Bourdj bouarreridj (11.76%), Setif (12.94%) and Batna (13.51%) regions (Table 2).

Table 2: D. gallinae infestation prevalence according to the different regions

Regions

Number hen farms

Number of infested farms

Bouira

88

16 (18.18%)

Bourdj bouarreridj

102

12 (11.76 %)

Setif

85

11 (12.94 %)

Batna

111

15 (13.51 %)

Total

386

54 (14 %)

19The age of the hens influences significantly the prevalence of infestation by D. gallinae. Indeed, the highest prevalence was reported in farms with older hens (˃40 weeks), 25.92%, and the lowest prevalence among farms with hens younger than 10 weeks (3.84%) (p < 0.001) (Table 3).

Table 3: Relation between age of hens and infestation by D. gallinae.

Hens age (weeks)

Infestation prevalence

< 10

3.93%

10-20

13.82%

20-40

11.21%

>40

25.92%

20The PCR assay showed that 25% of the pooled mite samples (08/32) were positive for Salmonella enterica and 6.25% for Salmonella enteritidis (02/32). No positive case was recorded for Salmonella typhimurium.

Discussion

21The results of this study constitute a first report in Algeria on the infestation of laying hens farms by D. gallinae and its vector role of Salmonella.

22Prevalence of infestation by D. gallinae in laying hens farms revealed in our study (14%) is lower in comparison with Tunisia and Morocco, where the prevalence of infested buildings was 38% (11) and 55% (25), respectively. In European countries the prevalence of infection exceeds 50%, it is estimated at 50% in Kosovo (13), 63.75% in Romania (16), 67% in France (15), 68% in Denmark (25), 87% in the UK (12) and 90% in Italy (17). In Asia, the prevalence is also high; it is 30.7% in Palestine (20), 39% in Iran (30) and 64.1% in China (29).

23European countries use an alternative breeding system that is more conducive to the development of this parasite than the cage system. In 2014, more than 160 million laying hens were reared in non-cage systems (1, 4, 8). Whereas, in Algeria, the cage system has been employed in all farms, which results in a lower prevalence as revealed in this study. Also, the study was performed in semi-arid regions. According to Nordenfors et al. (19), D. gallinae thrives in an environment with high humidity (at least 70%), whereas it does poorly in arid conditions because it cannot fully retain moisture.

24The higher infestation rate in the province of Bouira may be attributed to its more humid climate than the other regions.

25Sparagano et al. (25) reported that smaller farms were most affected by D. gallinae, because they are associated with bad sanitation practices and hygiene management. In our study, we didn’t find a difference in hygiene regarding to housing size.

26Farms with older flocks (aged ˃40 weeks) are the most affected by the parasite. This finding was consistent with Mul et al. (2010) who concluded that non-infested flocks were significantly less older (45 weeks) than the infested ones (52 weeks), similar results are found by Gharbi et al. (11).

27The visited farms used acceptable hygienic measures that made the environment less favourable for red mite multiplication. Othman et al. (20) indicated that among the factors favouring a high prevalence in Palestine (38%) is the very low cleaning frequency, which is manually performed in all farms. In China, where the prevalence of infection is high (64%), 32% of farmers do not clean, 55% do not use water for cleaning and 20% do not use disinfectant between flocks (29). Similar habits were observed in the Netherlands (prevalence, 80%), where 43% of farmers do not use water to clean their buildings between flocks (18).

28Red mite infection causes irritation and anaemia that manifest principally by decrease in egg production and death, in this study it can reach 10% and 2% respectively. Cencek (3) in a study realized in 06 battery cages showed a decline in egg production of 2-15%. While, Cosoroaba (5) found a minor increase in mortality rate (0.08%) and a drop in laying of 20% in a heavily infected henhouse in Roumania. Van Emous et al. (28) reported that the death rate among the hens can rise from 1 to 4%, with a reduction in laying performance of up to 10%.

29For the first time in Algeria, the current study provides molecular evidence for the involvement of red mites in the portage of S. enterica and S. enteritidis on laying hens farms.

30The public health consequences and economic impact of Salmonella in the Algerian poultry breeding sector are unknown because there are no epidemiological surveillance systems or monitoring programs for Salmonella infections in this country (2).

31In our study, out of the 32 infested farms, 8 samples were revealed by PCR positive for the presence of Salmonella enterica (14%) including 2 Salmonella enteritidis (6.25%). Hamidi et al. (13) reported that out of the eight infested farms in Kosovo, pooled mite samples from three premises were positive for the presence of Salmonella spp. (37.5%). This prevalence is higher than our finding.

32It has been shown that the mite can be infected through the blood meal or by cuticular contact (26) and because the red mite often hides under dry droppings which are frequently contaminated by Salmonella (27) and feed several times in each life stage on hens which increase the risk to transmit Salmonella and other pathogens. Consequently, mites infected by Salmonella constitute a potential reservoir host of this bacterium, permitting its persistence in the poultry house between flock cycles. Moreover, as Salmonella is a zoonotic agent, it remains to be clarified whether D. gallinae may act as a vector of Salmonella also to humans. An long sanitation period is not enough to eradicate this pest, the red mite is able to fasting for a long period time, more than six months (13). The application of a rigorous acaricide treatment is essential before the introduction of new batches pullets.

Conclusion

33The present study indicates for the first time in Algeria that D. gallinae can act as reservoir of Salmonella enterica and Salmonella enteritidis, allowing the propagation of this bacterium between successive flocks and between different farms. In further studies, it will be necessary to carry out a large-scale study to assess the role of D. gallinae in the epidemiology of avian salmonellosis.

Bibliography

  1. Arkle N., Guy J.H., Sparagano O., 2006, Immunological effects and productivity variation of red mite (Dermanyssus gallinae) on laying hens-implications for egg production and quality. World poultry science journal, 62, 249-257.

  2. Bouzidi N., Aoun L., Zeghdoudi M., Bensouilah M., Elgroud R., Oucief I., Granier S.A., Brisabois A., Desquilbet L., Millemann Y., 2012, Salmonella contamination of laying-hen flocks in two regions of Algeria. Food Research International, 45, 897-904.

  3. Cencek T., 2003, Prevalence of Dermanyssus gallinae in poultry farms in silesia region in Poland. Bulletin of the Veterinary Institute in Pulawy, 47, 465-469.

  4. Chirico J., Tauson R., 2002, Traps containing acaricides for the control of Dermanyssus gallinae. Veterinary parasitology, 110, 109-116.

  5. Cosoroaba I., 2001, Observation d'invasions massives par Dermanyssus gallinae (De geer 1778), chez les poules élevées en batterie en Roumanie, Revue de Médecine Vétérinaire, 152, 1, 89-96

  6. Davies R., Breslin M. 2003, Observations on Salmonella contamination of commercial laying farms before and after cleaning and disinfection.  Veterinary Record, 152, 283-287

  7. Di Palma A., Giangaspero A., Assunta M.C., Germinara G.S., 2012, A gallery of the key characters to ease identification of Dermanyssus gallinae (Acari: Gamasida: Dermanyssidae) and allow differentiation from Ornithonyssussylviarum (Acari: Gamasida: Macronyssidae). Parasites & Vectors, 104, p5.

  8. Fiddes M.D., Le Gresley S., Parsons D.G., Epe C., Coles G.C., Stafford K.A., 2005, Prevalence of the poultry red mite (Dermanyssus gallinae) in England. Veterinary Record, 157, 233–235.

  9. Fischer K., Walton S., 2014, Parasitic mites of medical and veterinary importance – is there a common research agenda? International journal of parasitology, 44, 955-967.

  10. George D.R., Finn R.D., Graham K.M., Mul M.F., Maurer V., Moro C.V., Sparagano O.A.E., 2015, Should the poultry red mite Dermanyssus gallinae be of wider concern for veterinary and medical science? Parasites & Vectors, 178 p8.

  11. Gharbi M., Sakly N., Darghouth A.M., 2013, Prevalence of Dermanyssus gallinae (Mesostigmata: Dermanyssidae) in industrial poultry farms in north-east Tunisia. Parasite, 20, p41.

  12. Guy J.H., Khajavi M., Hlalel M.M., Sparagano O.A.E., 2004, Mite (Dermanyssus gallinae) prevalence in laying units in northern England. British Poultry Science, 45, 15-16.

  13. Hamidi A, Sherifi K, Muji S., Behluli B., Latifi F., Robaj A., Postoli R., Hess C., Hess M., Sparagano O.A.E., 2011, Dermanyssus gallinae in layer farms in Kosovo: a high risk for salmonella prevalence. Parasites & Vectors, 4, 136.

  14. Liu B., Zhou X., Zhang L., Liu W., Dan X., Shi CH., Shim X., 2012, Development of a novel multiplex PCR assay for the identification of Salmonella Enterica, Typhimurium and Enteritidis. Food Control, 27, 87-93.

  15. Lubac S., Dernburg A., Bon G., Chauve C., Zenner L., 2003, Problématique et pratiques d’élevages en poules pondeuses dans le sud-est de la France contre les nuisibles: poux rouges et mouches. In: ITAVI, INRA, AFSSA (eds) 5emes journées de la recherche avicole, Tours, France, 26–27 mars 2003, 101–104

  16. Magdas C., Chirilă N.F., Fiń A.C., Baciu H., 2006, Epidemiologic study of Dermanyssus gallinae (acari: Dermanyssidae) infestation in birds, from three localities on Cluj area. Buletin USAMV-CN., 63, 309-314.

  17. Marangi M., Morelli V., Pati S., Camarda A., Cafiero MA., Giangaspero A., 2012, Acaricide residues in laying hens naturally infested by red mite Dermanyssus gallinae. Plosone, 7, issue 2, e31795.

  18. Mul M.F, Niekerk TGCM van, Reuvekamp BFJ, Emous RA van., 2010, Dermanyssus gallinae in dutch poultry farms: results of a questionnaire on severity, control treatments, cleaning, and biosecurity. Trends in Acarology: Proceedings of the 12th International Congress.

  19. Nordenfors H., Hoglund J., Uggla A., 1999, Effects of temperature and humidity on oviposition, moulting and longevity of Dermanyssus gallinae. Journal of Medical Entomology, 36, 68–72.

  20. Othman R.A., Abdallah J.M., Abo-Omar J., 2012, Prevalence of the red mite (Dermanyssus gallinae) in layer flocks in four districts in northern west bank. Palestine open journal of animal sciences, 2, 106-109.

  21. Pritchard J., Kustera T., Sparagano O.A.E., Tomley F., 2015, Understanding the biology and control of the poultry red mite Dermanyssus gallinae. Avian Pathology, 44, 143–153.

  22. Schulz J., Berk J., Suhl J., Schrader L., Kaufhold S., Mewis I., Hafez M.H., Ulrichs C., 2014, Characterization, mode of action, and efficacy of twelve silica-based acaricides against poultry red mite (Dermanyssus gallinae) in vitro. Parasitology Research, 113(9), 3167-75.

  23. Soon-li K., Young E.N., Ji-Hwan Y., Byung S.K., Young J.A., 2007, Contact and fumigant toxicity of oriental medicinal plant extracts against Dermanyssus gallinae (Acari: Dermanyssidae). Vet Parasitol 145, 377-382.

  24. Sparagano O.A.E., George D.R., Harrington D.W.J., Giangaspero A., 2014, Significance and control of the poultry red mite, Dermanyssus gallinae. Annual review of Entomology, 59, 466-447.

  25. Sparagano O.A.E., Pavlitevit A., Murano T., Camarda A., Sahibi H., Kilpinen O., Mul M.F., Van Emous R., Le Bouquin S., Hoel K., Cawero A.M., 2009, Prevalence and key figures for the poultry red mite Dermanyssus gallinae infections in poultry farm systems. Experimental and applied acarology, 48, 3–10.

  26. Valiente Moro C., Chauve C., Zenner L., 2007, Experimental infection of Salmonella Enteritidis by the poultry red mite, Dermanyssus gallinae. Veterinary parasitology, 146, 329–336.

  27. Valiente Moro C., Thioulouse J., Chauve C., Normand P., Zenner L., 2009, Bacterial taxa associated with the hematophagous mite Dermanyssus gallinae detected by 16S rRNA PCR amplification and TTGE fingerprinting, Research in microbiology, 160, 63-70.

  28. Van Emous R. A., Fiks-Van Niekerk T.G.C.M., Mul M.F., 2006, € 11 million damage for the sector: enquiry into the cost of mites to the poultry industry. De pluimveehouderij, 35:8-9.

  29. Wang F.F., Wang M., Xu F.R., Liang D.M., Pan B., 2010, Survey of prevalence and control of ectoparasites in caged poultry in china. Veterinary record, 167,934-937.

  30. Yakhchali M., Rasouli S., Alborzi E., 2013, Prevalence and body distribution of the poultry red mite in layer farms from Markazi province of Iran. Iranian journal of veterinary research, 14, 72-74.

To cite this article

M. Douifi, N. Ouchene, A. Hakem & K. Rahal, «Dermanyssus gallinae in Laying Hen Houses in Algeria, Infestation Prevalence and Molecular Detection of Salmonella », Tropicultura [En ligne], Volume 37 (2019), Numéro 4, URL : https://popups.uliege.be:443/2295-8010/index.php?id=1357.

About: M. Douifi

Algerian, PhD, Assistant professor/ researcher, Blida University 1, Laboratory of biotechnology related to animal reproduction, Blida, Algeria. National Institute of Veterinary Medicine, Central Veterinary Laboratory, Hacène Badi, El Harrach, Algiers, Algeria. Email: douifimohamed@gmail.com

About: N. Ouchene

Algerian, HDR, Lecturer/researcher, Blida University 1, Laboratory of biotechnology related to animal reproduction, Blida, Algeria

About: A. Hakem

Algerian, PhD, Professor, Lecturer/researcher, Ziane Achour University Laboratory for the exploitation and valorization of steppe ecosystems, Djelfa, Algeria

About: K. Rahal

Algerian, PhD, Professor, Lecturer/researcher, Blida University 1, Laboratory of biotechnology related to animal reproduction, Blida, Algeria